Prev. |  KEGG KO K01784 > 

RIKEN DNA Bank Human Resource - GALE

Gene ID NCBI Gene 2582 |  KEGG hsa:2582
Gene Symbol GALE
Protein Name UDP-galactose-4-epimerase
Synonyms SDR1E1
Ortholog resources KEGG ortholog (KEGG orthology K01784) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001946 IRAK004O10 pCMV-SPORT6 BC001273 NM_001008216 Full
HGX044276 IRAK110L12 pCMV-SPORT6 BC050685 NM_001008216 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056504 ARe41E08 pKA1U5 NM_000403.3  
GGCGGTGCCTCTGCAGCAAGCGTGGGGCGCGGGAACCCGAGCAGGACTCTCCAGTCCTCA
HKR074450 ARe86C02 pKA1U5 NM_000403.3  
GAGGCGGTGCCTCTGCAGCAAGCGTGGGGCGCGGGAACCCGAGCAGGACTCTCCAGTCCT
HKR162412 ARi06A12 pGCAP10 NM_000403.3  
GATTGGACAAGCCTGGGTCTGAGCAGACAGAACCCCTTCCTGCGACCCTGGAGTCCCAAT
HKR166901 ARi17E05 pGCAP10 NM_000403.3  
GGGTGCCTCTGCAGCAAGCGTGGGGCGCGGGAACCCGAGCAGGACTCTCCAGTCCTCAGT
HKR178481 ARi46D09 pGCAP10 NM_000403.3  
GGTGCCTCTGCAGCAAGCGTGGGGCGCGGGAACCCGAGCAGGACTCTCCAGTCCTCAGTC
HKR335201 RBb38A01 pGCAP1 NM_000403.3  
TGGCGGGCGGTGCCTCTGCAGCAAGCGTGGGGCGCGGGAACCCGAGCAGGACTCTCCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl