Prev. |  KEGG KO K01202 > 

RIKEN DNA Bank Human Resource - GALC

Gene ID NCBI Gene 2581 |  KEGG hsa:2581
Gene Symbol GALC
Protein Name galactosylceramidase
Synonyms -
Featured content Lysosome (human)
Ortholog resource in our bank

  GALC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01656 GL5 Human galactocerebrosidase cDNA
RDB02292 pAxCAhGALC (forward) Shuttle vector to produce rAd expressing human GALC
RDB02293 pAxCAhGALC (reverse) Shuttle vector to produce rAd expressing human GALC

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019067 IRAK047L03 pBluescriptR BC036518 NM_001037525 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041423 W01A103J07 pENTR-TOPO IRAK047L03 BC036518 NM_001037525  
HGE041427 W01A103J11 pENTR-TOPO IRAK047L03 BC036518 NM_001037525  
HGE041429 W01A103J13 pENTR-TOPO IRAK047L03 BC036518 NM_001037525  
HGE041433 W01A103J17 pENTR-TOPO IRAK047L03 BC036518 NM_001037525  
HGE041435 W01A103J19 pENTR-TOPO IRAK047L03 BC036518 NM_001037525  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082435 ARf06B11 pKA1U5 NM_000153.2  
GGCTGTGTGCGCTGCTGGCGCCCGGCGGCGCGNACGTTGCTCGACGACTCCGACGGGCTG
HKR209475 ARiS023L11 pGCAP10 NM_000153.2  
GACACAATGGCTGAGTGGCTACTCTCGGCTTCCTGGCAACGCCGAGCGAAAGCTATGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl