Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GABRB3

Gene ID (NCBI) 2562
Gene Symbol GABRB3
Protein Name gamma-aminobutyric acid (GABA) A receptor, beta 3
Synonyms ECA5
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05181)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180412 ARi51A12 pGCAP10 NM_000814.4  
GGCGGCGGCAGCAGCAGGAGCAGCCCCGGCTGCGGGTCGCGACGGCGGCGGGGCGCCCCC
HKR208355 ARiS020O19 pGCAP10 NM_000814.4  
GGCGGCGGCAGCAGCAGGAGCAGCCCCGGCTGCGGGTCGCGACGGCGGCGGGGCGCCCCC
HKR416006 RBdS040A06 pGCAP10 NM_000814.4  
GGCCGGAGGAACAGCGCCATGTGCTCCGGGCTCCTGGAGCTCCTGCTGCCCATCTGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.22

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl