Prev. |  KEGG KO K09454 > 

RIKEN DNA Bank Human Resource - GABPB1

Gene ID NCBI Gene 2553 |  KEGG hsa:2553
Gene Symbol GABPB1
Protein Name GA binding protein transcription factor beta subunit 1
Synonyms BABPB2|E4TF1|E4TF1-47|E4TF1-53|E4TF1B|GABPB|GABPB-1|GABPB2|NRF2B1|NRF2B2
Ortholog resources KEGG ortholog (KEGG orthology K09454) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011110 IRAK027M22 pCMV-SPORT6 BC016910 NM_002041 Full
HGY019456 IRAK048K16 pBluescriptR BC036080 NM_016654 Full/var
HGY085676 IRAL014D04 pOTB7 BC004103 NM_181427 Partial/var
HGY092192 IRAL030H24 pOTB7 BC014238 NM_181427

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021674 W01A054D02 pENTR-TOPO IRAK027M22 BC016910 NM_002041  
HGE021676 W01A054D04 pENTR-TOPO IRAK027M22 BC016910 NM_002041  
HGE021678 W01A054D06 pENTR-TOPO IRAK027M22 BC016910 NM_002041  
HGE021680 W01A054D08 pENTR-TOPO IRAK027M22 BC016910 NM_002041  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR377211 RBd43A11 pGCAP10 NM_002041.4  
GATTAAGGCGCCGGGTTTCCGGGGCTCCTGGCCCCGCTTATTCCGCGGGGGTCGGCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl