Prev. |  KEGG KO K08171 > 

RIKEN DNA Bank Human Resource - SLC37A4

Gene ID NCBI Gene 2542 |  KEGG hsa:2542
Gene Symbol SLC37A4
Protein Name solute carrier family 37 member 4
Synonyms G6PT1|G6PT2|G6PT3|GSD1b|GSD1c|GSD1d|PRO0685|TRG-19|TRG19
Ortholog resource in our bank

  SLC37A4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055679 IRAK139D07 pCMV-SPORT6 BC064563 NM_001467 Full
HGY080580 IRAL001H12 pOTB7 BC002400 NM_001467 Full
HGY083733 IRAL009F13 pOTB7 BC003589 NM_001467 Full
HGY093416 IRAL033I24 pOTB7 BC015650 NM_001467 Full
HGY093704 IRAL034E08 pOTB7 BC014663 NM_001467 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173258 ARi33C10 pGCAP10 NM_001467.5  
GGTCCTATTCGGGCTCCCGCCTCTGTTCAGGACACTGGGTCCCCTTGGAGCCTCCCCAGG
HKR209282 ARiS023D10 pGCAP10 NM_001467.5  
GGGGCTCCCGCCTCTGTTCAGGACACTGGGTCCCCTTGGAGCCTCCCCAGGCTTAATGAT
HKR234814 ARiS087A14 pGCAP10 NM_001467.5  
GGTCCTATTCGGGCTCCCGCCTCTGTTCAGGACACTGGGTCCCCTTGGAGCCTCCCCAGG
HKR428206 RBdS070I14 pGCAP10 NM_001467.5  
GGGGCTCCCGCCTCTGTTCAGGACACTGGGTCCCCTTGGAGCCTCCCCAGGCTTAATGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl