Prev. |  KEGG KO K04708 > 

RIKEN DNA Bank Human Resource - KDSR

Gene ID NCBI Gene 2531 |  KEGG hsa:2531
Gene Symbol KDSR
Protein Name 3-ketodihydrosphingosine reductase
Synonyms DHSR|EKVP4|FVT1|SDR35C1
Ortholog resource in our bank

  KDSR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084884 IRAL012D12 pOTB7 BC008797 NM_002035 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122146 ARh05G02 pGCAP1 NM_002035.2  
GGCCCCGGCCCGCAAACCCAAACACTCCAGGCGCCCGCCCGCCGCGCGTGATTCTCGCCT
HKR364953 RBd12G09 pGCAP10 NM_002035.2  
GCCCCTCCGCCGCGGCCCGCCCCGGCCCGCAAACCCAAACACTCCAGGCGCCCGCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl