Prev. |  KEGG KO K13098 > 

RIKEN DNA Bank Human Resource - FUS

Gene ID NCBI Gene 2521 |  KEGG hsa:2521
Gene Symbol FUS
Protein Name FUS RNA binding protein
Synonyms ALS6|ETM4|FUS1|HNRNPP2|POMP75|TLS
Ortholog resource in our bank

  FUS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14189 pEGFP-hTLS Expression vector of GFP-tagged human TLS.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080616 IRAL001I24 pOTB7 BC000402 NM_004960 Full
HGY082283 IRAL005L19 pOTB7 BC002459 NM_004960 Full
HGY090081 IRAL025D09 pOTB7 BC026062 NM_004960 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057210 ARe43A10 pKA1U5 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGNTGCTTGGAACTTCGTTGCTTGCTTGCC
HKR058898 ARe47E02 pKA1U5 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGCTTGGAACTTCGTTGCTTGCTTGCCT
HKR060508 ARe51E12 pKA1U5 NM_004960.2  
GTGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCNGTTGCTTGCTTGCC
HKR070057 ARe75C09 pKA1U5 NM_004960.2  
GGCTCAGATCCTCCAGGCGTCGGTGCTCAGCGGTGCTTGGAACTTCGTTGCTTGCTTGCC
HKR166032 ARi15B08 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR168429 ARi21B05 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR209557 ARiS023O21 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR235549 ARiS088O13 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR277920 ARiS194N08 pGCAP10 NM_004960.2  
GGCTCANTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR323730 RBb09F10 pKA1U5 NM_004960.2  
GCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTNGAACTTCGTTGCTTGCTTGCCTGT
HKR324450 RBb11C02 pKA1U5 NM_004960.2  
GGCGCGTGCGCGGACATGGCCTCAAACGATTATACCCAACAAGCAACCCAAAGCTATGGG
HKR361300 RBd03E04 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR369745 RBd24G01 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR384530 RBd61F10 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR386832 RBd67B08 pGCAP10 NM_004960.2  
GGCTCNNTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR387629 RBd69B05 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR399355 RBd98G11 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR409111 RBdS022M23 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR416021 RBdS040A21 pGCAP10 NM_004960.2  
GTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTGTG
HKR420543 RBdS051F23 pGCAP10 NM_004960.2  
GTCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR428072 RBdS070C24 pGCAP10 NM_004960.2  
TGGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCT
HKR430300 RBdS075M12 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR444294 RBdS110M06 pGCAP10 NM_004960.2  
GGCTCAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTG
HKR461662 RBdS154C14 pGCAP10 NM_004960.2  
GAGTCCTCCAGGCGTCGGTGCTCAGCGGTGTTGGAACTTCGTTGCTTGCTTGCCTGTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl