Prev. |  KEGG KO K01206 > 

RIKEN DNA Bank Human Resource - FUCA2

Gene ID NCBI Gene 2519 |  KEGG hsa:2519
Gene Symbol FUCA2
Protein Name alpha-L-fucosidase 2
Synonyms dJ20N2.5
Ortholog resource in our bank

  FUCA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082885 IRAL007D13 pOTB7 BC003060 NM_032020 Full/var
HGY098859 IRAL047C11 pOTB7 BC051268 NM_032020 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040454 ARe01C06 pKA1U5 NM_032020.3  
AATGGCGGCAGAGACGGAAGAACAGCGCTCCCGAGGCCGCGGGAGCCTGCAGAGAGGACA
HKR042403 ARe06A03 pKA1U5 NM_032020.3  
GGGCAGAGACGGAAGAACAGCGCTCCCGAGGCCGCGGGAGCCTGCAGAGAGGACAGCCGG
HKR073649 ARe84C01 pKA1U5 NM_032020.3  
GAGAGAGGACAGCCGGCCTGCGCCGGGACATGCGGCCCCAGGAGCTCCCCAGGCTCGCGT
HKR185722 ARi64F02 pGCAP10 NM_032020.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl