Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MTOR

Gene ID (NCBI) 2475
Gene Symbol MTOR
Protein Name mechanistic target of rapamycin kinase
Synonyms FRAP|FRAP1|FRAP2|RAFT1|RAPT1|SKS
Databases KEGG hsa:2475 |  NCBI Gene 2475
Featured content Jak-STAT signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07203)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384549 RBd61G05 pGCAP10 NM_004958.3  
AGAAGGTGCTGGATCTGAGTATAGTCTGGTTTCCCTCCTATGTATAGCCTCCAAGTCTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl