Prev. |  KEGG KO K09030 > 

RIKEN DNA Bank Human Resource - FOSL2

Gene ID NCBI Gene 2355 |  KEGG hsa:2355
Gene Symbol FOSL2
Protein Name FOS like 2, AP-1 transcription factor subunit
Synonyms FRA2
Ortholog resources KEGG ortholog (KEGG orthology K09030) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04671 pAxCALNLhFOSL2(forward) Shuttle vector to generate rAd expressing human FOSL2
RDB04665 pAxCALNLhFOSL2(reverse) Shuttle vector to generate rAd expressing human FOSL2
RDB06065 pCMFlag_hsFOSL2 Expression vector of human Fra2 (FOSL2).
RDB07273 pAxEFFlag_hsFOSL2it2 Shuttle vector to generate rAd harboring human FOSL2

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103782 IRAL059H14 pOTB7 BC085197
HGY091844 IRAL029K04 pOTB7 BC022791 NM_005253 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024959 W01A062G15 pENTR-TOPO IRAL029K04 BC022791 NM_005253  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173730 ARi34F10 pGCAP10 NM_005253.3  
GGTAGTGACTCATCTCGGGCAGAGCGCTAGGGCTCCGAGCGAACCAGCGAGCGAGCGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl