Prev. | Human A to Z list > F > 

RIKEN DNA Bank Human Resource - FOS

Gene ID (NCBI) 2353
Gene Symbol FOS
Protein Name Fos proto-oncogene, AP-1 transcription factor subunit
Synonyms AP-1|C-FOS|p55
Databases KEGG hsa:2353 |  NCBI Gene 2353
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04379)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05156 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)
RDB05157 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)
RDB05160 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)
RDB05161 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)
RDB05183 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)
RDB05184 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)
RDB05203 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)
RDB05204 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)
RDB06064 pCMFlag_hsFOS Expression vector of human FOS
RDB07292 pGL4-phFOS Promoter collection, Human FOS promoter
RDB07272 pAxEFFlag_hsFOSit2 Shuttle vector to generate rAd harboring human FOS

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085953 IRAL014O17 pOTB7 BC004490 NM_005252 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024843 W01A062B19 pENTR-TOPO IRAL014O17 BC004490 NM_005252  
HGE024845 W01A062B21 pENTR-TOPO IRAL014O17 BC004490 NM_005252  
HGE024847 W01A062B23 pENTR-TOPO IRAL014O17 BC004490 NM_005252  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277785 ARiS194H17 pGCAP10 NM_005252.2  
GAACCNCATCTGCAGCNAGCANCTGANAAGCCAAGACTGAGCCGGCGGCCGCGGCGCAGC
HKR370435 RBd26B11 pGCAP10 NM_005252.2  
GGCGGCGCCTCGTACTCCAACCGCATCTGCAGCGAGCAACTGAGAAGCCAAGACTGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl