DNA Bank Top |  KEGG KO K04379 > 

RIKEN DNA Bank Human Resource - FOS

Gene ID NCBI Gene 2353 |  KEGG hsa:2353
Gene Symbol FOS
Protein Name Fos proto-oncogene, AP-1 transcription factor subunit
Synonyms AP-1|C-FOS|p55
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes

Link

Ortholog resource in our bank

  FOS


External database

human FOS

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07292 pGL4-phFOS Promoter collection, Human FOS promoter    
RDB07272 pAxEFFlag_hsFOSit2 Shuttle vector to generate rAd harboring human FOS    
RDB06064 pCMFlag_hsFOS Expression vector of human FOS.    
RDB05204 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)    
RDB05203 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)    
RDB05184 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)    
RDB05183 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)    
RDB05161 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)    
RDB05160 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)    
RDB05157 pAxCALNLhc-fos (reverse) Shuttle vector to generate rAd harboring human c-fos (reverse)    
RDB05156 pAxCALNLhc-fos (forward) Shuttle vector to generate rAd harboring human c-fos (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085953 IRAL014O17 pOTB7 BC004490 NM_005252 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024843 W01A062B19 pENTR-TOPO IRAL014O17 BC004490 NM_005252  
HGE024845 W01A062B21 pENTR-TOPO IRAL014O17 BC004490 NM_005252  
HGE024847 W01A062B23 pENTR-TOPO IRAL014O17 BC004490 NM_005252  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277785 ARiS194H17 pGCAP10 NM_005252.2  
GAACCNCATCTGCAGCNAGCANCTGANAAGCCAAGACTGAGCCGGCGGCCGCGGCGCAGC
HKR370435 RBd26B11 pGCAP10 NM_005252.2  
GGCGGCGCCTCGTACTCCAACCGCATCTGCAGCGAGCAACTGAGAAGCCAAGACTGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl