Prev. |  KEGG KO K13649 > 

RIKEN DNA Bank Human Resource - FOLR3

Gene ID NCBI Gene 2352 |  KEGG hsa:2352
Gene Symbol FOLR3
Protein Name folate receptor gamma
Synonyms FR-G|FR-gamma|FRgamma|gamma-hFR
Featured content Endocytosis (human)
Ortholog resource in our bank

  FOLR3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048026 ARe20B02 pKA1U5 NM_000804.2  
GAATATTCAGAATTTGAGGAAACTAGGAAAAGCAGCAAACCAGATGGAGAAGGAAGGCCA
HKR172151 ARi30G07 pGCAP10 NM_000804.2  
GGAGGAAACTAGGAAAAGCAGCAAACCAGATGGAGAAGGAAGGCCAAAAAGATAAGTAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl