Prev. |  KEGG KO K05955 > 

RIKEN DNA Bank Human Resource - FNTA

Gene ID NCBI Gene 2339 |  KEGG hsa:2339
Gene Symbol FNTA
Protein Name farnesyltransferase, CAAX box, alpha
Synonyms FPTA|PGGT1A|PTAR2
Ortholog resources KEGG ortholog (KEGG orthology K05955) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008290 IRAK020M02 pCMV-SPORT6 BC017029 NM_002027 Partial
HGY103874 IRAL059L10 pOTB7 BC084566 NM_002027 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR121778 ARh04H10 pGCAP1 NM_002027.2  
GGCACCCACCGCCGCCCCAGCAGCAGCACAAGGAAGAGATGGCGGCCGAGGCTGGGGAAG
HKR361301 RBd03E05 pGCAP10 NM_002027.2  
GGGGCGGGGCCTCCGCCACCACCTCAGCTGCGGACCGAGGCGAGATGGCGGCCACCGAGG
HKR374949 RBd37G05 pGCAP10 NM_002027.2  
GACCTCAGCTGCGGACCGAGGCGAGATGGCGGCCACCGAGGGGGTCGGGGAGGCTGCGCA
HKR382530 RBd56F10 pGCAP10 NM_002027.2  
GGCGGACCGAGGCGAGATGGCGGCCACCGAGGGGGTCGGGGAGGCTGCGCAAGGGGGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl