Prev. |  KEGG KO K15516 > 

RIKEN DNA Bank Human Resource - FMR1

Gene ID NCBI Gene 2332 |  KEGG hsa:2332
Gene Symbol FMR1
Protein Name FMRP translational regulator 1
Synonyms FMRP|FRAXA|POF|POF1
Ortholog resource in our bank

  FMR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183608 ARi59A08 pGCAP10 NM_002024.4 done
GGTTTCGGTTTCACTTCCGGTGGACGGCCGCCTCTGATCGGGCGGCGGGCCGACGGCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl