Prev. |  KEGG KO K07192 > 

RIKEN DNA Bank Human Resource - FLOT2

Gene ID NCBI Gene 2319 |  KEGG hsa:2319
Gene Symbol FLOT2
Protein Name flotillin 2
Synonyms ECS-1|ECS1|ESA|ESA1|M17S1
Ortholog resource in our bank

  FLOT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095858 IRAL039K18 pOTB7 BC017292 NM_004475 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023240 W01A058B16 pENTR-TOPO IRAL039K18 BC017292 NM_004475  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348028 RBb70B04 pGCAP1 NM_004475.2 done
GTACTCCTGCCTCAACGCGCCGGCCCCGCCCTCCGCCGCCACACTTCCGGCGGGGCTTGC
HKR377610 RBd44A10 pGCAP10 NM_004475.2 done
GACCCGCTGCTGTTGTCCGGGTCTGTGCGGTCCCGAGGGCCCTCCGTGCCGCCGGCGCCA
HKR377611 RBd44A11 pGCAP10 NM_004475.2  
GGGCCGTGCGCAGCGGGTGAGGCCCGCGTGACGGCCGCTGAGCGTGCGCCTGGCGGGGCG
HKR396169 RBd90H01 pGCAP10 NM_004475.2 done
GGGGCGCGGCCGGCGCTGCAGACCCGCTGCTGTTGTCCGGGTCTGTGCGGTCCCGAGGGC
HKR461894 RBdS154M06 pGCAP10 NM_004475.2  
TGCAAGCAGGCTGGGGCTTGTTGGGGATTACCGGCACTGCCCGCCCAGGAGACGCGGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl