Prev. |  KEGG KO K04437 > 

RIKEN DNA Bank Human Resource - FLNA

Gene ID NCBI Gene 2316 |  KEGG hsa:2316
Gene Symbol FLNA
Protein Name filamin A
Synonyms ABP-280|ABPX|CSBS|CVD1|FLN|FLN-A|FLN1|FMD|MNS|NHBP|OPD|OPD1|OPD2|XLVD|XMVD
Ortholog resources KEGG ortholog (KEGG orthology K04437) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033603 IRAK084A03 pCMV-SPORT6 BC041179 NM_001456 Partial/var
HGX053935 IRAK134N23 pCMV-SPORT6.ccdb BC067111 NM_001456 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042525 ARe06F05 pKA1U5 NM_001456.3  
GAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCG
HKR050899 ARe27E03 pKA1U5 NM_001456.3  
GGGGCCAGAGCGCAGCAGGCGCGGCTCCGGGCNGCGTGCGATCGACACGCGGGACGCCGA
HKR165260 ARi13C12 pGCAP10 NM_001456.3  
GGGGCCAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGA
HKR174833 ARi37B09 pGCAP10 NM_001456.3  
GAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCG
HKR178951 ARi47G07 pGCAP10 NM_001456.3  
GGGGCCAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGA
HKR180009 ARi50A09 pGCAP10 NM_001456.3  
GAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCG
HKR186432 ARi66B08 pGCAP10 NM_001456.3  
GAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCG
HKR235429 ARiS088J13 pGCAP10 NM_001456.3  
GAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCG
HKR428382 RBdS070P22 pGCAP10 NM_001456.3  
GACCTCTGCTCCCTGCCTCGCCTCCCGCGCGCCTAGGTGCCTGCGACTTTAATTAAAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl