Prev. | 

RIKEN DNA Bank Human Resource - FLII

Gene ID NCBI Gene 2314 |  KEGG hsa:2314
Gene Symbol FLII
Protein Name FLII, actin remodeling protein
Synonyms FLI|FLIL|Fli1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001419 IRAK003J03 pCMV-SPORT6 BC021885 NM_002018 Partial/var
HGY096915 IRAL042E19 pOTB7 BC025300 NM_002018

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041756 ARe04G12 pKA1U5 NM_002018.2  
GAGCCCGGCGCGGCCCGGCAGCGAGAGCGGCGCCATGGTAGGCCACCGGGGATGCTGCCG
HKR056007 ARe40A07 pKA1U5 NM_002018.2  
GGGCAGCGAGAGCGGCGCCATGGTAGGCCACCGGGGTGCTGCCGTTCGTGCGTGGCGTGG
HKR067704 ARe69E08 pKA1U5 NM_002018.2  
GCCGGCAGCGAGAGCGGCGCCATGGAGGCCACCGGGGTGCTGCCGTTCGTGCGTGGCGTG
HKR234271 ARiS085L07 pGCAP10 NM_002018.2  
GAGCGAGAGCGGCGCCATGGAGGCCACCGGGGTGCTGCCGTTCGTGCGTGGCGTGGACCT
HKR444085 RBdS110D13 pGCAP10 NM_002018.2  
GGCCCTCGCCCCGGCGCTCCCTAGCCCGGCGCGGCCCGGCAGCGAGAGCGGCGCCATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl