Prev. |  KEGG KO K09406 > 

RIKEN DNA Bank Human Resource - FOXM1

Gene ID NCBI Gene 2305 |  KEGG hsa:2305
Gene Symbol FOXM1
Protein Name forkhead box M1
Synonyms FKHL16|FOXM1A|FOXM1B|FOXM1C|HFH-11|HFH11|HNF-3|INS-1|MPHOSPH2|MPP-2|MPP2|PIG29|TRIDENT
Ortholog resource in our bank

  FOXM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008729 IRAK021N17 pCMV-SPORT6 BC012863 NM_202003 Full/var
HGY085881 IRAL014L17 pOTB7 BC006192 NM_202003 Full/var
HGY085977 IRAL014P17 pOTB7 BC006529 NM_202003 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023154 W01A057O18 pENTR-TOPO IRAK021N17 BC012863 NM_202003  
HGE023156 W01A057O20 pENTR-TOPO IRAK021N17 BC012863 NM_202003 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162477 ARi06D05 pGCAP10 NM_021953.2  
TGAATTTCAAACAGCGGAACAAACTGAAAGCTCCGGTGCCAGACCCCACCCCCGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl