Prev. |  KEGG KO K09399 > 

RIKEN DNA Bank Human Resource - FOXF2

Gene ID NCBI Gene 2295 |  KEGG hsa:2295
Gene Symbol FOXF2
Protein Name forkhead box F2
Synonyms FKHL6|FREAC-2|FREAC2
Ortholog resource in our bank

  FOXF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186500 ARi66E04 pGCAP10 NM_001452.1 done
GAGAGCGAGGAGCGCTCCTGAAGGGAGACGTCGGGCTCGTCCCCGGGGTCCAGGCCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl