Prev. |  KEGG KO K09571 > 

RIKEN DNA Bank Human Resource - FKBP4

Gene ID NCBI Gene 2288 |  KEGG hsa:2288
Gene Symbol FKBP4
Protein Name FK506 binding protein 4
Synonyms FKBP51|FKBP52|FKBP59|HBI|Hsp56|PPIase|p52
Ortholog resources KEGG ortholog (KEGG orthology K09571) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083204 IRAL008A04 pOTB7 BC001786 NM_002014 Full
HGY088375 IRAL020P15 pOTB7 BC007924 NM_002014 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006846 W01A017B22 pENTR-TOPO IRAL008A04 BC001786 NM_002014  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176005 ARi40A05 pGCAP10 NM_002014.3  
GAGAGGTGCTCAAGCCTCCTCGCGGTCCGCAGTCAGTGCCGCCGCGCCCGGCCTCCCGCA
HKR182050 ARi55C02 pGCAP10 NM_002014.3  
GAGAGGTGCTCAAGCCTCCTCGCGGTCCGCAGTCAGTGCCGCCGCGCCCGGCCTCCCGCA
HKR203246 ARiS008B22 pGCAP10 NM_002014.3  
GGTCAGTGCCGCCGCGCCCGGCCTCCCGCACGCCCCGCAGGTAGCGCCCCCGCCCGCGGC
HKR360402 RBd01A02 pGCAP10 NM_002014.3  
GAGTGCCGCCGCGCCCGGCCTCCCGCACGCCCCGCAGGTAGCGCCCCCGCCCGCGGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl