Prev. |  KEGG KO K09570 > 

RIKEN DNA Bank Human Resource - FKBP3

Gene ID NCBI Gene 2287 |  KEGG hsa:2287
Gene Symbol FKBP3
Protein Name FK506 binding protein 3
Synonyms FKBP-25|FKBP-3|FKBP25|PPIase
Ortholog resources KEGG ortholog (KEGG orthology K09570) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03763 SEREX clone NGO-St-076 (ID 546) #1 SEREX clone NGO-St-076 (ID 546) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006283 IRAK015L19 pCMV-SPORT6 BC016288 NM_002013
HGY094436 IRAL036B12 pDNR-LIB BC020809 NM_002013 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004722 W01A011N10 pENTR-TOPO IRAK015L19 BC016288 NM_002013  
HGE004728 W01A011N16 pENTR-TOPO IRAK015L19 BC016288 NM_002013  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052806 ARe32A06 pKA1U5 NM_002013.2  
GAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGCAGCTGCGC
HKR166149 ARi15G05 pGCAP10 NM_002013.2  
GGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGCAGCTGCGCAGTGA
HKR247378 ARiS118H10 pGCAP10 NM_002013.2  
GGAGTAAAGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACC
HKR264747 ARiS161O11 pGCAP10 NM_002013.2  
TGGGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGCAGC
HKR330006 RBb25A06 pGCAP1 NM_002013.2  
GGTAAAGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGT
HKR339351 RBb48G07 pGCAP1 NM_002013.2  
GGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGCAG
HKR343352 RBb58G08 pGCAP1 NM_002013.2  
GGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGC
HKR365682 RBd14D10 pGCAP10 NM_002013.2  
GAAAGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGG
HKR385209 RBd63A09 pGCAP10 NM_002013.2  
GAAAGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGG
HKR398473 RBd96D01 pGCAP10 NM_002013.2  
GAAAGCGGAGGCAGCGGGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGG
HKR441924 RBdS104N12 pGCAP10 NM_002013.2  
TGGGAAGATGGCGGCGGCCGTTCCACAGCGGGCGTGGACCGTGGAGCAGCTGCGCAGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl