Prev. |  KEGG KO K09569 > 

RIKEN DNA Bank Human Resource - FKBP2

Gene ID NCBI Gene 2286 |  KEGG hsa:2286
Gene Symbol FKBP2
Protein Name FK506 binding protein 2
Synonyms FKBP-13|PPIase
Ortholog resources KEGG ortholog (KEGG orthology K09569) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001439 IRAK003J23 pCMV-SPORT6 BC003384 NM_057092 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020873 W01A052D01 pENTR-TOPO IRAK003J23 BC003384 NM_057092  
HGE020877 W01A052D05 pENTR-TOPO IRAK003J23 BC003384 NM_057092  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041706 ARe04E10 pKA1U5 NM_004470.3  
GGCAGAGGCGGCAGCACCACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGG
HKR052454 ARe31C06 pKA1U5 NM_004470.3  
GAGAGGCGGCAGCACCACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCT
HKR056977 ARe42H09 pKA1U5 NM_004470.3  
GGTGGCCCGGCCTGGTAGCGACGAGGACGCGCCTGCNCAGAGGCGGCAGCACCACCGGGG
HKR064481 ARe61D09 pKA1U5 NM_004470.3  
GGCGGATGCCAAGGAGCCAAGTGAGGAGCCTGGCCCNTNANACATGAGGCTGAGCTGGTT
HKR075257 ARe88C09 pKA1U5 NM_004470.3  
ACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCTGAGCTGGTTCCGGGTC
HKR078506 ARe96E10 pKA1U5 NM_004470.3  
TCCCTCGCTCCGGGTGTGCCCCAAATAAACTCAGGAACGCCCCGGNTGAAAAAAAAAAAA
HKR163298 ARi08E02 pGCAP10 NM_004470.3  
TTGGAGGGTCTAAGTCCGGGCAGCCGAAGAGTGTGGTAGGTAACGGTCCTCAGCGCAAGG
HKR334100 RBb35E04 pGCAP1 NM_004470.3  
CCACCGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCTGAGCTGGTTCCGGG
HKR347630 RBb69B06 pGCAP1 NM_004470.3  
GCGGGGCTCGGGAAAGACCCGTGCCAGCGGGCGTGTGGCCGCGGGTTTCGCACGGTCCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl