Prev. |  KEGG KO K09568 > 

RIKEN DNA Bank Human Resource - FKBP1A

Gene ID NCBI Gene 2280 |  KEGG hsa:2280
Gene Symbol FKBP1A
Protein Name FK506 binding protein 1A
Synonyms FKBP-12|FKBP-1A|FKBP1|FKBP12|PKC12|PKCI2|PPIASE
Ortholog resources KEGG ortholog (KEGG orthology K09568) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082919 IRAL007E23 pOTB7 BC005147 NM_054014 Full
HGY083904 IRAL009M16 pOTB7 BC001925 NM_054014 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000505 W01A001E09 pENTR-TOPO IRAL007E23 BC005147 NM_054014  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047751 ARe19G07 pKA1U5 NM_054014.2  
GGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCG
HKR066499 ARe66E03 pKA1U5 NM_054014.2  
GGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATG
HKR081308 ARf03E12 pKA1U5 NM_054014.2  
GGCTCAGCGNTCCGCCGCCGCCATGGGAGTGCAGGCTGGAAACCATCTCCCCAGGAGACG
HKR166527 ARi16F07 pGCAP10 NM_054014.2  
GGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCATG
HKR173636 ARi34B12 pGCAP10 NM_054014.2  
GGCGTGCGCAGGCGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGC
HKR182156 ARi55G12 pGCAP10 NM_054014.2  
GGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGC
HKR203279 ARiS008D07 pGCAP10 NM_054014.2  
GGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCC
HKR203575 ARiS008P15 pGCAP10 NM_054014.2  
GGCNNAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCC
HKR234998 ARiS087I06 pGCAP10 NM_054014.2  
CGCGCTCATCGTCCGCCGCCGCCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACG
HKR243952 ARiS109O16 pGCAP10 NM_054014.2  
GGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCC
HKR334921 RBb37F01 pGCAP1 NM_054014.2  
TGGAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCC
HKR337373 RBb43H05 pGCAP1 NM_054014.2  
GGCTGTTGGTCCACGCCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCGCCAT
HKR346527 RBb66F07 pGCAP1 NM_054014.2  
TTTGTCGCTGTTGGTCCACGCCGCCCGTCGCGCCGCCCGCCCGCTCAGCGTCCGCCGCCG
HKR370805 RBd27A05 pGCAP10 NM_054014.2  
GGGCGCGTGCGCAGGCGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGT
HKR374479 RBd36D07 pGCAP10 NM_054014.2  
GACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGC
HKR381770 RBd54H02 pGCAP10 NM_054014.2  
GGCAGGCGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCCNCGCNNGGTCGCTGTTGG
HKR390482 RBd76D10 pGCAP10 NM_054014.2  
GGCAGGNGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGG
HKR405314 RBdS013E18 pGCAP10 NM_054014.2  
GGGGCGTGCGCGTGCGCAGGCGACGCGCCGAGGTACTAGGCAGAGCCGTGGAACCGCCGC
HKR475039 RBdS187J23 pGCAP10 NM_054014.2  
GACTAGGCAGAGCCGTGGAACCGCCGCCAGGTCGCTGTTGGTCCACGCCGCCCGTCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl