Prev. | 

RIKEN DNA Bank Human Resource - FHL3

Gene ID NCBI Gene 2275 |  KEGG hsa:2275
Gene Symbol FHL3
Protein Name four and a half LIM domains 3
Synonyms SLIM2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080775 IRAL001P15 pOTB7 BC001351 NM_004468 Full
HGY084333 IRAL010N21 pOTB7 BC001351 NM_004468 Full
HGY090881 IRAL027D09 pOTB7 BC011697 NM_004468 Full
HGY093722 IRAL034F02 pOTB7 BC014501 NM_004468 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR080573 ARf01H05 pKA1U5 NM_004468.3  
GACGGTCCGTCTGCAGTCGGCAGCCTCGCCGGCAGCTCGCTCGGCCCCCGCTTGGCCCGG
HKR342499 RBb56E03 pGCAP1 NM_004468.3  
GAGTCGGCAGCCTCGCCGGCAGCTCGCTCGGCCCCCGCTTGGCCCGGCCCGCAGGTAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl