Prev. |  KEGG KO K14380 > 

RIKEN DNA Bank Human Resource - FHL2

Gene ID NCBI Gene 2274 |  KEGG hsa:2274
Gene Symbol FHL2
Protein Name four and a half LIM domains 2
Synonyms AAG11|DRAL|FHL-2|SLIM-3|SLIM3
Ortholog resource in our bank

  FHL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083288 IRAL008D16 pOTB7 BC014397 NM_201557 Full
HGY089696 IRAL024D24 pOTB7 BC012742 NM_201557 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001027 W01A002J11 pENTR-TOPO IRAL008D16 BC014397 NM_201557  
HGE001029 W01A002J13 pENTR-TOPO IRAL008D16 BC014397 NM_201557  
HGE001031 W01A002J15 pENTR-TOPO IRAL008D16 BC014397 NM_201557  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046107 ARe15E11 pKA1U5 NM_001450.3  
GGTCCCCGGCCCGCTGCGGTGCCGTGAGTACCTCCAACCCCCTGCGCCCCGGAGGGAGGC
HKR209379 ARiS023H11 pGCAP10 NM_001450.3  
GGAGGGCGGGAGCTGCGCAGCGCTCCACTCGGCCGGCAGCGGAGCCGCAGCCACCAGCCG
HKR332874 RBb32D02 pGCAP1 NM_001450.3  
GACTCGGCCGGCAGCGGAGCCGCAGCCACCAGCCGCCCGCGCCCTCCAGCCCCGTCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl