Prev. |  KEGG KO K01679 > 

RIKEN DNA Bank Human Resource - FH

Gene ID NCBI Gene 2271 |  KEGG hsa:2271
Gene Symbol FH
Protein Name fumarate hydratase
Synonyms FMRD|HLRCC|LRCC|MCL|MCUL1
Ortholog resources KEGG ortholog (KEGG orthology K01679) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082620 IRAL006J04 pOTB7 BC003108 NM_000143 Full
HGY089519 IRAL023N07 pOTB7 BC017444 NM_000143 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044026 ARe10B02 pKA1U5 NM_000143.2  
ACTTCGGCTCCTCGCGCGCTCGCGTCCCCTCGNTGCGGGCTCCAGCCGCAGCCTTAGCTT
HKR333354 RBb33G10 pGCAP1 NM_000143.2  
GGTCTCGCGTCCCCTCGTGCGGGCTCCAGCCGCAGCCTTAGCTTCGGCTCCCGGCTTGGG
HKR474860 RBdS187C12 pGCAP10 NM_000143.2  
GGCCNNNNAATTCTACCCAAGCTCCCTCAGCACCATGTACCGAGCACTTCGGCTCCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl