Prev. |  KEGG KO K04362 > 

RIKEN DNA Bank Human Resource - FGFR1

Gene ID NCBI Gene 2260 |  KEGG hsa:2260
Gene Symbol FGFR1
Protein Name fibroblast growth factor receptor 1
Synonyms BFGFR|CD331|CEK|ECCL|FGFBR|FGFR-1|FLG|FLT-2|FLT2|HBGFR|HH2|HRTFDS|KAL2|N-SAM|OGD|bFGF-R-1
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  FGFR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18382 pcDNA3-FGFR1-cHis Expression vector of human FGFR1.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006170 IRAK015H02 pCMV-SPORT6 BC015035 NM_023109 Full/var
HGX005794 IRAK014I02 pCMV-SPORT6 BC018128 NM_023109 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE083222 M01C008A22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083270 M01C008C22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083318 M01C008E22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083366 M01C008G22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083414 M01C008I22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083462 M01C008K22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083510 M01C008M22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083558 M01C008O22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016769 W01A041P09 pENTR-TOPO IRAK014I02 BC018128 NM_023109  
HGE016773 W01A041P13 pENTR-TOPO IRAK014I02 BC018128 NM_023109  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067275 ARe68D03 pKA1U5 NM_023110.2  
GGCATAGCGCTCGGAGCGCTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCA
HKR180097 ARi50E01 pGCAP10 NM_023110.2  
GGCATAGCGCTCGGAGCGCTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl