Prev. | Human A to Z list > F > 

RIKEN DNA Bank Human Resource - FGFR1

Gene ID (NCBI) 2260
Gene Symbol FGFR1
Protein Name fibroblast growth factor receptor 1
Synonyms BFGFR|CD331|CEK|FGFBR|FGFR-1|FLG|FLT-2|FLT2|HBGFR|HH2|HRTFDS|KAL2|N-SAM|OGD|bFGF-R-1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005794 IRAK014I02 pCMV-SPORT6 BC018128 NM_023109 Full/var
HGX006170 IRAK015H02 pCMV-SPORT6 BC015035 NM_023109 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE083222 M01C008A22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083270 M01C008C22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083318 M01C008E22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083366 M01C008G22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083414 M01C008I22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083462 M01C008K22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083510 M01C008M22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  
HGE083558 M01C008O22 pDONR221 FLJ01-F11 AK130555 ENST00000341462  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016769 W01A041P09 pENTR-TOPO IRAK014I02 BC018128 NM_023109  
HGE016773 W01A041P13 pENTR-TOPO IRAK014I02 BC018128 NM_023109  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180097 ARi50E01 pGCAP10 NM_023110.2  
GGCATAGCGCTCGGAGCGCTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCA
HKR067275 ARe68D03 pKA1U5 NM_023110.2  
GGCATAGCGCTCGGAGCGCTCTTGCGGCCACAGGCGCGGCGTCCTCGGCGGCGGGCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl