Prev. |  KEGG KO K04358 > 

RIKEN DNA Bank Human Resource - FGF5

Gene ID NCBI Gene 2250 |  KEGG hsa:2250
Gene Symbol FGF5
Protein Name fibroblast growth factor 5
Synonyms HBGF-5|Smag-82|TCMGLY
Ortholog resources KEGG ortholog (KEGG orthology K04358) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050412 ARe26A12 pKA1U5 NM_004464.3  
GGCTCGGGTGGCCTCTCTCTTCCCCTCTCCCCTTCTCTTCCCCGAGGCTATGTCCACCCG
HKR235399 ARiS088I07 pGCAP10 NM_004464.3  
GGCTCGGGTGGCCTCTCTCTTCCCCTCTCCCCTTCTCTTCCCCGAGGCTATGTCCACCCG
HKR247338 ARiS118F18 pGCAP10 NM_004464.3  
GGCTCGGGTGNCCTCTCTCTTCCCCTCTCCCCTTCTCTTCCCCGAGGCTATGTCCACCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl