Prev. | Human A to Z list > F > 

RIKEN DNA Bank Human Resource - FEN1

Gene ID (NCBI) 2237
Gene Symbol FEN1
Protein Name flap structure-specific endonuclease 1
Synonyms FEN-1|MF1|RAD2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04799)


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162553 ARi06G09 pGCAP10 NM_004111.4  
GACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCC
HKR170055 ARi25C07 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR209446 ARiS023K06 pGCAP10 NM_004111.4 done
TTGGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCCGA
HKR330807 RBb27A07 pGCAP1 NM_004111.4  
GGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCT
HKR335754 RBb39G10 pGCAP1 NM_004111.4  
TGGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGC
HKR373352 RBd33G08 pGCAP10 NM_004111.4  
GACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCC
HKR347370 RBb68H02 pGCAP1 NM_004111.4  
TGGCGAGCCTGCGATTTGGGTGTAGAGGGAGCAGGGGCTTGCGGGGACCTGGTGTGGGTG
HKR396457 RBd91C09 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR405558 RBdS013O22 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR432717 RBdS081N05 pGCAP10 NM_004111.4  
GGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCCGAACCAAGCTTTAGC
HKR433390 RBdS083H22 pGCAP10 NM_004111.4  
GAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl