Prev. |  KEGG KO K04799 > 

RIKEN DNA Bank Human Resource - FEN1

Gene ID NCBI Gene 2237 |  KEGG hsa:2237
Gene Symbol FEN1
Protein Name flap structure-specific endonuclease 1
Synonyms FEN-1|MF1|RAD2
Featured content DNA repair (human)
Ortholog resource in our bank

  FEN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162553 ARi06G09 pGCAP10 NM_004111.4 done
GACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCC
HKR170055 ARi25C07 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR209446 ARiS023K06 pGCAP10 NM_004111.4 done
TTGGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCCGA
HKR330807 RBb27A07 pGCAP1 NM_004111.4  
GGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCT
HKR335754 RBb39G10 pGCAP1 NM_004111.4  
TGGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGC
HKR347370 RBb68H02 pGCAP1 NM_004111.4  
TGGCGAGCCTGCGATTTGGGTGTAGAGGGAGCAGGGGCTTGCGGGGACCTGGTGTGGGTG
HKR373352 RBd33G08 pGCAP10 NM_004111.4  
GACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCC
HKR396457 RBd91C09 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR405558 RBdS013O22 pGCAP10 NM_004111.4  
GGGCTGAACGTCAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCC
HKR432717 RBdS081N05 pGCAP10 NM_004111.4  
GGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCAACCCCGAACCAAGCTTTAGC
HKR433390 RBdS083H22 pGCAP10 NM_004111.4  
GAGGCCACCCGCCGCTAAGCTGAGAAGGGAGAGCGAGCTTAGGACCGCCTGCCCGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl