Prev. |  KEGG KO K00787 > 

RIKEN DNA Bank Human Resource - FDPS

Gene ID NCBI Gene 2224 |  KEGG hsa:2224
Gene Symbol FDPS
Protein Name farnesyl diphosphate synthase
Synonyms FPPS|FPS|POROK9
Ortholog resources KEGG ortholog (KEGG orthology K00787) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090684 IRAL026L20 pOTB7 BC010004 NM_002004

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050102 ARe25E06 pKA1U5 NM_002004.3  
GACCGAGCAGGAATCCGTATCTGGGAACAGAATGAACGGAGACCAGAATTCAGATGTTTA
HKR053634 ARe34B10 pKA1U5 NM_002004.3  
GGATTCTGCTTTTAGGAGTACCCGCCAACAAGCGGGACCGAGCAGGAATCCGTATCTGGG
HKR055278 ARe38D06 pKA1U5 NM_002004.3  
GACCGAGCAGGAATCCGTATCTGGGAACAGAATGAACGGAGACCAGAATTCAGATGTTTA
HKR058552 ARe46G08 pKA1U5 NM_002004.3  
GAGGAGTACCCGCCAACAAGCGGGACCGAGCANCCAATNCGTATCTGGGAACAGAATGAA
HKR062430 ARe56B06 pKA1U5 NM_002004.3  
GGAGCAGGAATCCGTTATCTGGGAACAGAATGANCCGATAACCAGAATTCAGATGTTTAT
HKR073207 ARe83A07 pKA1U5 NM_002004.3  
GGAGCAGGAATCCGTATCTGGGAACAGGTGAGAGAGGATGTGTGCTGGGCCTTGGAGGAA
HKR164428 ARi11B04 pGCAP10 NM_002004.3  
GACCGAGCAGGAATCCGTATCTGGGAACAGAATGAACGGAGACCAGAATTCAGATGTTTA
HKR181208 ARi53A08 pGCAP10 NM_002004.3  
GCTTAGTGTGGGGAGAGCGGGAACTACTCGACCCACAGAGCCGATCGCGGAGCGGATTCT
HKR182809 ARi57A09 pGCAP10 NM_002004.3  
GACTCGACCCACAGAGCCGATCGCGGAGCGGATTCTGCTTTTAGGAGTACCCGCCAACAA
HKR185327 ARi63F07 pGCAP10 NM_002004.3  
GATCTGGGAACAGGTGAGAGAGGATGTGTGCTGGGCCTTGGAGGAAGGGGGCCGAGACCG
HKR188406 ARi71A06 pGCAP10 NM_002004.3  
GGACCCACAGAGCCGATCGCGGAGCGGATTCTGCTTTTAGGAGTACCCGCCAACAAGCGG
HKR203203 ARiS008A03 pGCAP10 NM_002004.3  
GAGGAGTACCCGCCAACAAGCGGGACCGAGCAGGAATCCGTATCTGGGAACAGAATGAAC
HKR205286 ARiS013D14 pGCAP10 NM_002004.3  
GAGGAGTACCCGCCAACAAGCGGGACCGAGCAGGAATCCGTATCTGGGAACAGAATGAAC
HKR219696 ARiS049D24 pGCAP10 NM_002004.3  
GGATTCTGCTTTTAGGAGTACCCGCCAACAAGCGGGACCGAGCAGGAATCCGTATCTGGG
HKR222054 ARiS055C06 pGCAP10 NM_002004.3  
GACTCGACCCACAGAGCCGATCGCGGAGCGGATTCTGCTTTTAGGAGTACCCGCCAACAA
HKR264691 ARiS161M03 pGCAP10 NM_002004.3  
GGAGCAGGAATCCGTATCTGGGAACAGGATGCCCCTGTCCCGCTGGTTGAGATCTGTGGG
HKR390180 RBd75H12 pGCAP10 NM_002004.3  
TTGGGACCGAGCAGGAATCCGTATCTGGGAACAGAGCCCTTTGCTCCTCCCTCAGAATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl