Prev. |  KEGG KO K00801 > 

RIKEN DNA Bank Human Resource - FDFT1

Gene ID NCBI Gene 2222 |  KEGG hsa:2222
Gene Symbol FDFT1
Protein Name farnesyl-diphosphate farnesyltransferase 1
Synonyms DGPT|ERG9|SQS|SS
Ortholog resources KEGG ortholog (KEGG orthology K00801) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011786 IRAK029H18 pCMV-SPORT6 BC029641 NM_004462 Full
HGY083581 IRAL008P21 pOTB7 BC003573 NM_004462 Full
HGY084371 IRAL010P11 pOTB7 BC009251 NM_004462 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006640 W01A016J24 pENTR-TOPO IRAL010P11 BC009251 NM_004462  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058060 ARe45C12 pKA1U5 NM_004462.3  
GGCCTGGGGACCGCAGAGGTGAGAGTCGCGCCCGGGAGTCCGCCGCCTGCGCCAGGATGG
HKR066411 ARe66A11 pKA1U5 NM_004462.3  
ATCCTGGCCCCTCGAAGCACCTACTCCACAGGTCCAGCCGGCCGGTGAGCGCCTGGGGAC
HKR071610 ARe79A10 pKA1U5 NM_004462.3  
GCCCCTGNTCCGGCCAGCCCCTCGAAGCACCTACTCCACAGGTCCAGCCGGCCGGTGAGC
HKR072079 ARe80D07 pKA1U5 NM_004462.3  
GGGGGACCGCAGAGGTGAGAGTCGCGCCCGGGAGTCCGCCGCCTGCGCCAGGATGGAGTT
HKR080974 ARf02H06 pKA1U5 NM_004462.3  
AGAGGTGAGAGTCGCGCCCGGGAGTCCGCCGCCTGCGCCAGGATGGAGTTCGTGAAATGC
HKR175750 ARi39G06 pGCAP10 NM_004462.3  
GGGTGAGCGCCTGGGGACCGCAGAGGTGAGAGTCGCGCCCGGGAGTCCGCCGCCTGCGCC
HKR235521 ARiS088N09 pGCAP10 NM_004462.3  
GAGAGGTGAGAGTCGCGCCCGGGAGTCCGCCGCCTGCGCCAGGATGGAGTTCGTGAAATG
HKR370076 RBd25D04 pGCAP10 NM_004462.3  
GGTCCGGCCAGCCCCTCGAAGCACCTACTCCACAGGTCCAGCCGGCCGGTGAGCGCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl