Prev. |  KEGG KO K02983 > 

RIKEN DNA Bank Human Resource - FAU

Gene ID NCBI Gene 2197 |  KEGG hsa:2197
Gene Symbol FAU
Protein Name FAU ubiquitin like and ribosomal protein S30 fusion
Synonyms FAU1|Fub1|Fubi|MNSFbeta|RPS30|S30|asr1
Ortholog resources KEGG ortholog (KEGG orthology K02983) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044067 IRAK110C19 pCMV-SPORT6 BC051834
HGX031943 IRAK079O07 pCMV-SPORT6 BC033877 NM_001997 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042947 ARe07G03 pKA1U5 NM_001997.3  
TGCTTCCTCTTTCTCGACTCCATCTTCGCGGTACCTGGGACCGCCGTTCAGATCGCCAAT
HKR050873 ARe27D01 pKA1U5 NM_001997.3  
GCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTT
HKR052524 ARe31F04 pKA1U5 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAATATGCA
HKR054003 ARe35A03 pKA1U5 NM_001997.3  
GTCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAAT
HKR056451 ARe41C03 pKA1U5 NM_001997.3  
GCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATAT
HKR060532 ARe51F12 pKA1U5 NM_001997.3  
GCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGCTTCAGATCGCCAAT
HKR060580 ARe51H12 pKA1U5 NM_001997.3  
GTTCCTCTTTCTCGACTCCATCTTCGCGGGTAGCTGGGACCGCCGCTTCAGATCNCCAAT
HKR062576 ARe56H08 pKA1U5 NM_001997.3  
GCTTTCTCGACTCCATCTTCGCGGTAGCTGGGNCCNTCNNTTCAGTCGCCAATATGCAGC
HKR069308 ARe73E12 pKA1U5 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGNACCGCCGCTTCAGTCGCCAATATGCA
HKR075772 ARe89H04 pKA1U5 NM_001997.3  
GGACACGCAGCCCACGGNTCTGTACTGACGCGCCCTCGCTTCTTCCTCTTTCTCGACTCC
HKR077682 ARe94D10 pKA1U5 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAATATGCA
HKR078435 ARe96B11 pKA1U5 NM_001997.3  
GCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTT
HKR078801 ARe97A01 pKA1U5 NM_001997.3  
CCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGCTTCAGTCGCCAATATGCA
HKR081322 ARf03F02 pKA1U5 NM_001997.3  
GCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAATA
HKR082099 ARf05E03 pKA1U5 NM_001997.3  
GCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAATATGC
HKR160578 ARi01H10 pGCAP10 NM_001997.3  
CTCTTTCTCCACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGC
HKR163205 ARi08A05 pGCAP10 NM_001997.3  
GGCTTCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCA
HKR163304 ARi08E08 pGCAP10 NM_001997.3  
GCTCAGCCACCGCTGCGNCTCTCTCACTCTGTTCTTCCGCAGATCCGCCGTCNCGTTTCT
HKR175202 ARi38A02 pGCAP10 NM_001997.3  
CTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGC
HKR175634 ARi39B10 pGCAP10 NM_001997.3  
GTTTCTCGACTCCAGCTTCGCGGGAGGTGGGAGCGCCGTTCAGTGGCAAATTTGTCTCTC
HKR176430 ARi41B06 pGCAP10 NM_001997.3  
GAGCAGTGACGTGACACGCAGCCCACGGTCTGTACTGACGCGCCCTCGCTTCTTCCTCTT
HKR182151 ARi55G07 pGCAP10 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAG
HKR187679 ARi69D07 pGCAP10 NM_001997.3  
GCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTT
HKR218359 ARiS045O23 pGCAP10 NM_001997.3  
HKR219797 ARiS049I05 pGCAP10 NM_001997.3  
GGGGTTGCTGGGCTGGGCTTGCTGAGGTAGAGGCAGCGCCAAGAAGAGGCCTTTGCCGCT
HKR219798 ARiS049I06 pGCAP10 NM_001997.3  
GCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTT
HKR222148 ARiS055G04 pGCAP10 NM_001997.3  
GCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATAT
HKR260015 ARiS150A15 pGCAP10 NM_001997.3  
GAGCAGTGACGTGACACGCAGCCCACGGTCTGTACTGACGCGCCCTCGCTTCTTCCTCTT
HKR276725 ARiS191N13 pGCAP10 NM_001997.3  
GGTACTGACGCGCCCTCGCTTCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGAC
HKR277790 ARiS194H22 pGCAP10 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAG
HKR277880 ARiS194L16 pGCAP10 NM_001997.3  
TGGCTCNNNTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCT
HKR327300 RBb18E04 pKA1U5 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGNTTCAGTCGCCAATATGCA
HKR332904 RBb32E08 pGCAP1 NM_001997.3  
TGGTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGC
HKR335724 RBb39F04 pGCAP1 NM_001997.3  
TGCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCA
HKR344805 RBb62A05 pGCAP1 NM_001997.3  
AGTGAGAGGTCAGACTCCTAAGGTGGCCAAACAGGAGAAGAAGAAGAAGAAGACAGGTCG
HKR345230 RBb63B06 pGCAP1 NM_001997.3  
GCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGCTCTTT
HKR387208 RBd68A08 pGCAP10 NM_001997.3  
GTTTTCTCGACTCCNTCTTCGCGGTAGCTGGGACCGCCGTTCACTCNCCAATATGCAGCT
HKR396170 RBd90H02 pGCAP10 NM_001997.3  
GCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATAT
HKR430312 RBdS075M24 pGCAP10 NM_001997.3  
GGCTTCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCA
HKR433296 RBdS083D24 pGCAP10 NM_001997.3  
CTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAGC
HKR444157 RBdS110G13 pGCAP10 NM_001997.3  
TTCTTCCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATA
HKR461676 RBdS154D04 pGCAP10 NM_001997.3  
GCTCTTTCTCGACTCCATCTTCGCGGTAGCTGGGACCGCCGTTCAGTCGCCAATATGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl