Prev. |  KEGG KO K01889 > 

RIKEN DNA Bank Human Resource - FARSA

Gene ID NCBI Gene 2193 |  KEGG hsa:2193
Gene Symbol FARSA
Protein Name phenylalanyl-tRNA synthetase subunit alpha
Synonyms CML33|FARSL|FARSLA|FRSA|PheHA
Ortholog resource in our bank

  FARSA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035064 IRAK087K24 pCMV-SPORT6 BC043565 NM_004461 Partial
HGY080987 IRAL002H19 pOTB7 BC006495 NM_004461 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002042 W01A005B18 pENTR-TOPO IRAL002H19 BC006495 NM_004461  
HGE002046 W01A005B22 pENTR-TOPO IRAL002H19 BC006495 NM_004461  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366123 RBd15F03 pGCAP10 NM_004461.2  
GACACTGGAAGGAGTCATGGCGGATGGTCAGGTGGCGGAACTGCTGCTCCGGCGGCTGGA
HKR367377 RBd18H09 pGCAP10 NM_004461.2  
GACTGGAAGGAGTCATGGCGGATGGTCAGGTGGCGGAACTGCTGCTCCGGCGGCTGGAGG
HKR416209 RBdS040I17 pGCAP10 NM_004461.2  
GGGAAGGAGTCATGGCGGATGGTCAGGTGGCGGAACTGCTGCTCCGGCGGCTGGAGGCGT
HKR433503 RBdS083M15 pGCAP10 NM_004461.2  
GACTGGAAGGAGTCATGGCGGATGGTCAGGTGGCGGAACTGCTGCTCCGGCGGCTGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl