Prev. |  KEGG KO K17307 > 

RIKEN DNA Bank Human Resource - FBLN1

Gene ID NCBI Gene 2192 |  KEGG hsa:2192
Gene Symbol FBLN1
Protein Name fibulin 1
Synonyms FBLN|FIBL1
Ortholog resources KEGG ortholog (KEGG orthology K17307) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013175 IRAK032P15 pBluescriptR BC022497 NM_006487 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089208 M01C023A08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089256 M01C023C08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089304 M01C023E08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089352 M01C023G08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089400 M01C023I08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089448 M01C023K08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089496 M01C023M08 pDONR221 MGC01-B04 BC022497 ENST00000262722  
HGE089544 M01C023O08 pDONR221 MGC01-B04 BC022497 ENST00000262722  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041337 W01A103F17 pENTR-TOPO flj0027m20 AK075566 NM_006487  
HGE041339 W01A103F19 pENTR-TOPO flj0027m20 AK075566 NM_006487  
HGE041343 W01A103F23 pENTR-TOPO flj0027m20 AK075566 NM_006487  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR279544 ARiS198O08 pGCAP10 NM_001996.2  
GGTTGGCTGCCGAGGCTCGGCCGGAGCGTGGAGCCCGCGCCGCTGCCCCAGGACCGCGCC
HKR333678 RBb34D06 pGCAP1 NM_001996.2  
GGTTGGCTGCCGAGGNCTCGGCCGGAGCGTGNAGNCCGCGCCCCNTNNCCCAGGACCGNG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl