Prev. |  KEGG KO K01897 > 

RIKEN DNA Bank Human Resource - ACSL4

Gene ID NCBI Gene 2182 |  KEGG hsa:2182
Gene Symbol ACSL4
Protein Name acyl-CoA synthetase long chain family member 4
Synonyms ACS4|FACL4|LACS4|MRX63|MRX68|XLID63
Ortholog resource in our bank

  ACSL4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013380 IRAK033H12 pBluescriptR BC034959 NM_004458 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041481 W01A103L17 pENTR-TOPO IRAK033H12 BC034959 NM_004458  
HGE041483 W01A103L19 pENTR-TOPO IRAK033H12 BC034959 NM_004458  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050901 ARe27E05 pKA1U5 NM_004458.2  
ATCCTGGCTCTGGCCTCCGCCGCGCGCTCCTCCNCTTNCCAGCGCTAGCGGGCACGCGGT
HKR069303 ARe73E07 pKA1U5 NM_004458.2  
TCCGCCGGCTGTCCGGGTGCGCGCGCGCCGCTNCNTNTTTTTCTCTGGCCTCCGCCGCGC
HKR074078 ARe85D06 pKA1U5 NM_004458.2  
GGCCTCCGCCGGCTGTCCGGGTGCGCGCGCGCCGCTGCGGCTTTTTCTCTGGCCTCCGCC
HKR173724 ARi34F04 pGCAP10 NM_004458.2  
GCTCTGGCCTCCGCCGCGCGCTCCTCCTCGTCCCAGCGCTAGCGGGCACGCGGTTCCTTT
HKR208352 ARiS020O16 pGCAP10 NM_004458.2  
GGTCCGGGTGCGCGCGCGCCGCTGCGGCTTTTTCTCTGGCCTCCGCCGCGCGCTCCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl