Prev. |  KEGG KO K01897 > 

RIKEN DNA Bank Human Resource - ACSL3

Gene ID NCBI Gene 2181 |  KEGG hsa:2181
Gene Symbol ACSL3
Protein Name acyl-CoA synthetase long chain family member 3
Synonyms ACS3|FACL3|LACS 3|LACS3|PRO2194
Ortholog resource in our bank

  ACSL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033704 IRAK084E08 pCMV-SPORT6 BC041692 NM_203372 Full
HGY095692 IRAL039D20 pOTB7 BC032144 NM_203372 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR390457 RBd76C09 pGCAP10 NM_004457.3  
GAGACGCTGCTGTGGCTGCGCCGGGCTGCGACACTGCAGTTGTCTACGCGGCCGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl