Prev. |  KEGG KO K10892 > 

RIKEN DNA Bank Human Resource - FANCE

Gene ID NCBI Gene 2178 |  KEGG hsa:2178
Gene Symbol FANCE
Protein Name FA complementation group E
Synonyms FACE|FAE
Ortholog resource in our bank

  FANCE

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR365283 RBd13D11 pGCAP10 NM_021922.2 done
GCCCTCCTTCCCTTTCCGACAGCGCGGGAACGGCTGCGGCTTCGGGCGGCCGGGTTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl