Prev. |  KEGG KO K08754 > 

RIKEN DNA Bank Human Resource - FABP5

Gene ID NCBI Gene 2171 |  KEGG hsa:2171
Gene Symbol FABP5
Protein Name fatty acid binding protein 5
Synonyms E-FABP|EFABP|KFABP|PA-FABP|PAFABP
Ortholog resource in our bank

  FABP5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008556 IRAK021G12 pCMV-SPORT6 BC019385 NM_001444 Full
HGY103026 IRAL057J10 pDNR-LIB BC070303 NM_001444 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164082 ARi10D10 pGCAP10 NM_001444.1  
GACAGCACGCTGCCACGCCGACGCAGACCCCTCTCTGCACGCCAGCCCGCCCGCACCCAC
HKR183332 ARi58F12 pGCAP10 NM_001444.1  
GACAGCACGCTGCCACGCCGACGCAGACCCCTCTCTGCACGCCAGCCCGCCCGCACCCAC
HKR235485 ARiS088L21 pGCAP10 NM_001444.1  
TTGACACAGCACGCTGCCACGCCGACGCAGACCCCTCTCTGCACGCCAGCCCGCCCGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl