Prev. |  KEGG KO K03901 > 

RIKEN DNA Bank Human Resource - F3

Gene ID NCBI Gene 2152 |  KEGG hsa:2152
Gene Symbol F3
Protein Name coagulation factor III, tissue factor
Synonyms CD142|TF|TFA
Ortholog resource in our bank

  F3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07458 pGL4-phF3 Promoter collection, Human F3 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087670 IRAL019C22 pDNR-LIB BC011029 NM_001993 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044049 ARe10C01 pKA1U5 NM_001993.3  
GAGACTGCGAGCTCCCCGCACCCCCTCGCACTCCCTCATGGCCGGCCCAGGGCGCCTTCA
HKR179301 ARi48E05 pGCAP10 NM_001993.3  
GGCGGGAGAGCGCGCCGCCGGCCCTTTATAGCGCGCGGGGCACCGGCTCCCCAAGACTGC
HKR222206 ARiS055I14 pGCAP10 NM_001993.3  
GCTAAGACTGCGAGCTCCCCGCACCCCCTCGCACTCCCTCTGGCCGGCCCAGGGCGCCTT
HKR238576 ARiS096H08 pGCAP10 NM_001993.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl