Prev. |  KEGG KO K03914 > 

RIKEN DNA Bank Human Resource - F2R

Gene ID NCBI Gene 2149 |  KEGG hsa:2149
Gene Symbol F2R
Protein Name coagulation factor II thrombin receptor
Synonyms CF2R|HTR|PAR-1|PAR1|TR
Featured content Endocytosis (human)
Ortholog resource in our bank

  F2R

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044310 IRAK110M22 pCMV-SPORT6 BC051909 NM_001992 Full/var
HGY082363 IRAL005P03 pOTB7 BC002464 NM_001992 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025018 W01A062J02 pENTR-TOPO IRAL005P03 BC002464 NM_001992  
HGE025022 W01A062J06 pENTR-TOPO IRAL005P03 BC002464 NM_001992  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067703 ARe69E07 pKA1U5 NM_001992.3  
GCCCCGCCCCGCTAACCGCCCCAGACACAGCGCTCGCCGAGGGTCGCTTGGACCCTGATC
HKR068474 ARe71D02 pKA1U5 NM_001992.3  
GGCCCCGCCCCGCTAACCGCCCCAGACACAGCGCTCNCCGAGGGTCGCTTGGACCCTGAT
HKR166005 ARi15A05 pGCAP10 NM_001992.3  
GCCAGACACAGCGCTCGCCGAGGGTCGCTTGGACCCTGATCTTACCCGTGGGCACCCTGC
HKR336804 RBb42A04 pGCAP1 NM_001992.3  
GCCCGCCCCGCTACCGCCCCAGACACAGCGCTCGCCGAGGGTCGCTTGGACCCTGATCTT
HKR367721 RBd19F01 pGCAP10 NM_001992.3  
GCCCAGACACAGCGCTCGCCGAGGGTCGCTTGGACCCTGATCTTACCCGTGGGCACCCTG
HKR374126 RBd35F06 pGCAP10 NM_001992.3  
GGCCCCGCCCCGCTAACCGCCCCAGACACAGCGCTCGCCGAGGGTCGCTTGGACCCTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl