DNA Bank Top |  KEGG KO K11430 > 

RIKEN DNA Bank Human Resource - EZH2

Gene ID NCBI Gene 2146 |  KEGG hsa:2146
Gene Symbol EZH2
Protein Name enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms ENX-1|ENX1|EZH2b|KMT6|KMT6A|WVS|WVS2

Link

Ortholog resource in our bank

  EZH2


External database

human EZH2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07370 pGL4-phEZH2 Promoter collection, Human EZH2 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005918 IRAK014N06 pCMV-SPORT6 BC010858 NM_004456 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332574 RBb31H06 pGCAP1 NM_004456.3  
AGAAGGCAGTGGAGCCCCGGCGGCGGCGGCGGCGGCGCGCGGGGGCGACGCGCGGGAACA
HKR340451 RBb51C03 pGCAP1 NM_004456.3  
GGAAGGCAGTGGAGCCCCGGCGGCGGCGGCGGCGGCGCGCGGGGGCGACGCGCGGGAACA
HKR379230 RBd48B06 pGCAP10 NM_004456.3  
GAGAAGGCAGTGGAGCCCCGGCGGCGGCGGCGGCGGCGCGCGGGGGCGACGCGCGGGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl