Prev. |  KEGG KO K02367 > 

RIKEN DNA Bank Human Resource - EXT2

Gene ID NCBI Gene 2132 |  KEGG hsa:2132
Gene Symbol EXT2
Protein Name exostosin glycosyltransferase 2
Synonyms SOTV|SSMS
Ortholog resource in our bank

  EXT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067047 IRAK167K07 pBluescriptR BC068545 NM_207122 Full/var
HGY091045 IRAL027K05 pOTB7 BC010058 NM_207122 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166851 ARi17C03 pGCAP10 NM_000401.2  
GATGCGCAGTGCGCTCGGTGTCAGACGGCCCGGATCCCGGTTACCGGCCCCTCGCTCGCT
HKR173772 ARi34H04 pGCAP10 NM_000401.2  
GAGACGGCCCGGATCCCGGTTACCGGCCCCTCGCTCGCTGCTCGCCAGCCCAGACTCGGC
HKR208383 ARiS020P23 pGCAP10 NM_000401.2  
GCCCGGATCCCGGTTACCGGCCCCTCGCTCGCTGCTCGCCAGCCCAGACTCGGCCCTGGC
HKR219662 ARiS049C14 pGCAP10 NM_000401.2  
GGGCCCCTCGCTCGCTGCTCGCCAGCCCAGACTCGGCCCTGGCAGTGGCGGCTGGCGATT
HKR248967 ARiS122G23 pGCAP10 NM_000401.2  
GGTTACCGGCCCCTCGCTCGCTGCTCGCCAGCCCAGACTCGGCCCTGGCAGTGGCGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl