Prev. |  KEGG KO K19605 > 

RIKEN DNA Bank Human Resource - EVC

Gene ID NCBI Gene 2121 |  KEGG hsa:2121
Gene Symbol EVC
Protein Name EvC ciliary complex subunit 1
Synonyms DWF-1|EVC1|EVCL
Ortholog resource in our bank

  EVC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235584 ARiS088P24 pGCAP10 NM_153717.2  
GACAGAAAAACCCAGGTCTGTCACCAGCAGGGCGGGCACCATCTCTGCAGCCGACACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl