Prev. |  KEGG KO K03521 > 

RIKEN DNA Bank Human Resource - ETFB

Gene ID NCBI Gene 2109 |  KEGG hsa:2109
Gene Symbol ETFB
Protein Name electron transfer flavoprotein subunit beta
Synonyms FP585|MADD
Ortholog resource in our bank

  ETFB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03737 SEREX clone NGO-St-085 (ID556) #1 SEREX clone NGO-St-085 (ID556) #1
RDB03775 SEREX clone NGO-St-085 (ID556) #2 SEREX clone NGO-St-085 (ID556) #2

webcatalog20220516.tab


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014658 W01A036K18 pENTR-TOPO flj0008k14 AK055285 NM_001014763  
HGE014662 W01A036K22 pENTR-TOPO flj0008k14 AK055285 NM_001014763  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046529 ARe16F09 pKA1U5 NM_001985.2  
GGGGGCTTCTGGACTGAGCCGCTGAGGGTGCGGGCTGACCCTGNTAAGTGGCTGCGGCGG
HKR366576 RBd16H08 pGCAP10 NM_001985.2  
GAGAGAGGGGCGCGGGGGGCGGGGGTGGTGGGGTTTTTGACACCTCCCCACCCCCTCATT
HKR406218 RBdS015J02 pGCAP10 NM_001985.2  
GGGGGCTTCTGGACTGAGCCGCTGAGGGTGCGGGCTGACCCTGTAAGTGGCTGCGGCGGG
HKR444312 RBdS110M24 pGCAP10 NM_001985.2  
TGGGACCCTGTAAGTGGCTGCGGCGGGAAGATGGCGGAGCTGCGCGTGCTCGTAGCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl