Prev. |  KEGG KO K03265 > 

RIKEN DNA Bank Human Resource - ETF1

Gene ID NCBI Gene 2107 |  KEGG hsa:2107
Gene Symbol ETF1
Protein Name eukaryotic translation termination factor 1
Synonyms D5S1995|ERF|ERF1|RF1|SUP45L1|TB3-1
Ortholog resources KEGG ortholog (KEGG orthology K03265) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13269 pGEX6P-eRF1 Expression vector of human eRF1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085651 IRAL014C03 pOTB7 BC014269 NM_004730 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366452 RBd16C04 pGCAP10 NM_004730.2  
GAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGACAGGAACGTGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl