Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ERCC4

Gene ID (NCBI) 2072
Gene Symbol ERCC4
Protein Name ERCC excision repair 4, endonuclease catalytic subunit
Synonyms ERCC11|FANCQ|RAD1|XFEPS|XPF
Databases KEGG hsa:2072 |  NCBI Gene 2072
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10848)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01785 pcDNA3-XPF Human ERCC4 cDNA
RDB02327 pAxCAhXPF (reverse) Shuttle vector to produce rAd expressing human XPF
RDB02328 pAxCAhXPF (forward) Shuttle vector to produce rAd expressing human XPF

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367677 RBd19D05 pGCAP10 NM_005236.2  
GAGCCGGCTCGACGGATTGCCATGGCGCCGCTGCTGGAGTACGAGCGACAGCTGGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl