Prev. | 

RIKEN DNA Bank Human Resource - ERCC4

Gene ID NCBI Gene 2072 |  KEGG hsa:2072
Gene Symbol ERCC4
Protein Name ERCC excision repair 4, endonuclease catalytic subunit
Synonyms ERCC11|FANCQ|RAD1|XFEPS|XPF
Featured content DNA repair (human)
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01785 pcDNA3-XPF Human ERCC4 cDNA
RDB02327 pAxCAhXPF (reverse) Shuttle vector to produce rAd expressing human XPF
RDB02328 pAxCAhXPF (forward) Shuttle vector to produce rAd expressing human XPF

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367677 RBd19D05 pGCAP10 NM_005236.2 done
GAGCCGGCTCGACGGATTGCCATGGCGCCGCTGCTGGAGTACGAGCGACAGCTGGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl