Prev. |  KEGG KO K10843 > 

RIKEN DNA Bank Human Resource - ERCC3

Gene ID NCBI Gene 2071 |  KEGG hsa:2071
Gene Symbol ERCC3
Protein Name ERCC excision repair 3, TFIIH core complex helicase subunit
Synonyms BTF2|GTF2H|RAD25|TFIIH|TTD2|XPB
Featured content DNA repair (human)
Ortholog resource in our bank

  ERCC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR079351 ARe98G07 pKA1U5 NM_000122.1  
GAGAGCGGATGCCGCGGCGGGCCTGTGGGAGCGGGGTCATCTTCTCTCTGCTGCTGTAGC
HKR366569 RBd16H01 pGCAP10 NM_000122.1  
GGGTGNTTTGGGGGNTTGCGTGTGGGAGCGGGGTCATCTTCTCTCTGCTGCTGTAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl