Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ERCC3

Gene ID (NCBI) 2071
Gene Symbol ERCC3
Protein Name excision repair cross-complementing rodent repair deficiency, complementation group 3
Synonyms BTF2|GTF2H|RAD25|TFIIH|XPB
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR079351 ARe98G07 pKA1U5 NM_000122.1
GAGAGCGGATGCCGCGGCGGGCCTGTGGGAGCGGGGTCATCTTCTCTCTGCTGCTGTAGC
HKR366569 RBd16H01 pGCAP10 NM_000122.1
GGGTGNTTTGGGGGNTTGCGTGTGGGAGCGGGGTCATCTTCTCTCTGCTGCTGTAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.18

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl