Prev. |  KEGG KO K10849 > 

RIKEN DNA Bank Human Resource - ERCC1

Gene ID NCBI Gene 2067 |  KEGG hsa:2067
Gene Symbol ERCC1
Protein Name ERCC excision repair 1, endonuclease non-catalytic subunit
Synonyms COFS4|RAD10|UV20
Featured content DNA repair (human)
Ortholog resource in our bank

  ERCC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046366 IRAK115P06 pCMV-SPORT6 BC052813 NM_202001 Full
HGY080845 IRAL002B21 pOTB7 BC008930 NM_001983 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010171 W01A025H03 pENTR-TOPO IRAL002B21 BC008930 NM_001983  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051658 ARe29C10 pKA1U5 NM_001983.2  
GAGTCTTTCCCTTGAGGCTCCAAGACCAGCAGGTGAGGCCTCGCGGCGCTGAAACCGTGA
HKR222339 ARiS055O03 pGCAP10 NM_001983.2  
GCGAGCCCTGGGCCACGCTGGCCGTGCTGGCAGTGGGCCGCCTCGATCCCTCTGCAGTCT
HKR249164 ARiS122P04 pGCAP10 NM_001983.2  
GAGAGCCTCTAGCGCTGGGTGTTGGGGACCTGACGCTATGGAGCTCTCGGAGTTTTGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl