DNA Bank Top |  KEGG KO K05083 > 

RIKEN DNA Bank Human Resource - ERBB2

Gene ID NCBI Gene 2064 |  KEGG hsa:2064
Gene Symbol ERBB2
Protein Name erb-b2 receptor tyrosine kinase 2
Synonyms CD340|HER-2|HER-2/neu|HER2|MLN 19|MLN-19|NEU|NGL|TKR1|VSCN2|c-ERB-2|c-ERB2|p185(erbB2)
Featured content HIF-1 signaling pathway - human

Link

Ortholog resource in our bank

  ERBB2


External database

human ERBB2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB02843 c-erbB2 promoter(251)-TK Expressing thymidine kinase driven by c-erbB2    
RDB02842 c-erbB2 promoter(124)-pGL2-basic Luciferase reportor driven by c-erbB2    
RDB02841 c-erbB2 promoter(251)-pGL2-basic Luciferase reportor driven by c-erbB2    
RDB02840 c-erbB2 promoter(344)-pGL2-basic Luciferase reportor driven by c-erbB2    
RDB02839 c-erbB2 promoter(533)-pGL2-basic Luciferase reportor driven by c-erbB2    
RDB01273 pSV2 erb B2 Human erb B2 cDNA expression vector    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069876 IRAK174L12 pCMV-SPORT6 BC080193 NM_004448 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014926 W01A037F06 pENTR-TOPO flj0079g05 AK131568 NM_004448  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR369259 RBd23C11 pGCAP10 NM_001005862.1  
GGTTCTTTATTCTACTCTCCGCTGAAGTCCACACAGTTTAAATTAAAGTTCCCGGATTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl