Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NR2F6

Gene ID (NCBI) 2063
Gene Symbol NR2F6
Protein Name nuclear receptor subfamily 2, group F, member 6
Synonyms EAR-2|EAR2|ERBAL2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX054262 IRAK135K22 pCMV-SPORT6 BC063018 NM_005234 Full
HGY085005 IRAL012I13 pOTB7 BC002669 NM_005234 Full
HGY103692 IRAL059D20 pOTB7 BC084544 NM_005234 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE048320 W01A120N08 pENTR-TOPO IRAL012I13 BC002669 NM_005234  
HGE048322 W01A120N10 pENTR-TOPO IRAL012I13 BC002669 NM_005234  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR323201 RBb08A01 pKA1U5 NM_005234.3  
GGCCCGCCCCGCGAATGGAACGCTGTGTGTCAAACCGGCCGCAGCGCGAGGCCGGCGCGC
HKR372076 RBd30D04 pGCAP10 NM_005234.3  
GGAACGCTGTGTGTCAAACCGGCCGCAGCGCGAGGCCGGCGCGCGGGGTCGGTGGCGGTG
HKR428184 RBdS070H16 pGCAP10 NM_005234.3  
GGNNNNTGNNNCTCTGTGTGNCANNCCAGCCGCANCGCNANGCCGGCGCGCGGGGTCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.04.24

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl